Быстрый заказ

Text Size:AAA

Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SFTPD Информация о продукте «Клон cDNA»
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Mus musculus surfactant associated protein D with N terminal Myc tag.
Синоним гена:SP-D, Sftp4, AI573415, Sftpd
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50205-ACGRBS15400
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50205-ACRRBS15400
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50205-CFRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50205-CHRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50205-CMRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50205-CYRBS13340
Мышь SFTPD/SP-D Джин клон кДНК в вектор клонированияMG50205-MRBS5130
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50205-NFRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50205-NHRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50205-NMRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50205-NYRBS13340
Мышь SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмидыMG50205-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Surfactant pulmonary-associated protein D, also known as SFTPD and SP-D, is a member of the collectin family of C-type lectins that is synthesized in many tissues including respiratory epithelial cells in the lung, and contains one C-type lectin domain and one collagen-like domain. The polymorphic variation in the N-terminal domain of the SP-D molecule influences oligomerization, function, and the concentration of the molecule in serum. SFTPD is produced primarily by alveolar type II cells and nonciliated bronchiolar cells in the lung and is constitutively secreted into the alveoli where it influences surfactant homeostasis, effector cell functions, and host defense. It is upregulated in a variety of inflammatory and infectious conditions including Pneumocystis pneumonia and asthma. SFTPD is humoral molecules of the innate immune system, and is considered a functional candidate in chronic periodontitis. Besides it is involved in the development of acute and chronic inflammation of the lung. Several human lung diseases are characterized by decreased levels of bronchoalveolar SFTPD. Thus, recombinant SFTPD has been proposed as a therapeutical option for cystic fibrosis, neonatal lung disease and smoking-induced emphysema. Furthermore, SFTPD serum levels can be used as disease activity markers for interstitial lung diseases.

  • Leth-Larsen R, et al. (2005) A common polymorphism in the SFTPD gene influences assembly, function, and concentration of surfactant protein D. J Immunol. 174(3): 1532-8.
  • Moran AP, et al. (2005) Role of surfactant protein D (SP-D) in innate immunity in the gastric mucosa: evidence of interaction with Helicobacter pylori lipopolysaccharide. J Endotoxin Res. 11(6): 357-62.
  • Hartl D, et al. (2006) Surfactant protein D in human lung diseases. Eur J Clin Invest. 36(6): 423-35.
  • Krueger M, et al. (2006) Amino acid variants in Surfactant protein D are not associated with bronchial asthma. Pediatr Allergy Immunol. 17(1): 77-81.
  • Glas J, et al. (2008) Increased plasma concentration of surfactant protein D in chronic periodontitis independent of SFTPD genotype: potential role as a biomarker. Tissue Antigens. 72(1): 21-8.
  • Size / Price
    Каталог: MG50205-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.