Быстрый заказ

Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SERPIND1 Информация о продукте «Клон cDNA»
Размер кДНК:1437bp
Описание кДНК:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade D, member 1 with N terminal His tag.
Синоним гена:HCII, Hcf2, AA985900, AI303446, MGC107662
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50121-ACGRBS15400
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50121-ACRRBS15400
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50121-CFRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50121-CHRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50121-CMRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50121-CYRBS13340
Мышь SerpinD1 Джин клон кДНК в вектор клонированияMG50121-MRBS5130
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50121-NFRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50121-NHRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50121-NMRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50121-NYRBS13340
Мышь SerpinD1 Джин ORF экспрессии кДНК клона плазмидыMG50121-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • Size / Price
    Каталог: MG50121-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.