Быстрый заказ

Text Size:AAA

Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SERPINB6B Информация о продукте «Клон cDNA»
Размер кДНК:1134bp
Описание кДНК:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6b with C terminal Myc tag.
Синоним гена:NK13, Spi12, ovalbumin, Serpinb6b
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50371-ACGRBS15400
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50371-ACRRBS15400
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50371-ANGRBS15400
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50371-ANRRBS15400
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50371-CFRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50371-CHRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50371-CMRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50371-CYRBS13340
Мышь Serpinb6b Джин клон кДНК в вектор клонированияMG50371-MRBS5130
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50371-NFRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50371-NHRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50371-NMRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50371-NYRBS13340
Мышь Serpinb6b Джин ORF экспрессии кДНК клона плазмидыMG50371-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Morgenstern KA, et al. (1994) Complementary DNA cloning and kinetic characterization of a novel intracellular serine proteinase inhibitor: mechanism of action with trypsin and factor Xa as model proteinases. Biochemistry. 33(11): 3432-41.
  • Strik MC, et al. (2004) Intracellular serpin SERPINB6 (PI6) is abundantly expressed by human mast cells and forms complexes with beta-tryptase monomers. Blood.103(7): 2710-7.
  • Scott FL, et al. (2007) SerpinB6 is an inhibitor of kallikrein-8 in keratinocytes. J Biochem. 142(4): 435-42.
  • Size / Price
    Каталог: MG50371-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.