Быстрый заказ

Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SERPINB6 Информация о продукте «Клон cDNA»
Размер кДНК:1137bp
Описание кДНК:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6a with C terminal Myc tag.
Синоним гена:Spi3, AI876477, Serpinb6, ovalbumin, 4930482L21Rik, D330015H01Rik, Serpinb6a
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50374-ACGRBS15400
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50374-ACRRBS15400
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50374-ANGRBS15400
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50374-ANRRBS15400
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50374-CFRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50374-CHRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50374-CMRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50374-CYRBS13340
Мышь SerpinB6 Джин клон кДНК в вектор клонированияMG50374-MRBS5130
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50374-NFRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50374-NHRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50374-NMRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50374-NYRBS13340
Мышь SerpinB6 Джин ORF экспрессии кДНК клона плазмидыMG50374-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

  • Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.
  • Strik MC. et al., 2004, Blood. 103: 2710-7.
  • Scott FL. et al., 2007, J Biochem. 142: 435-42.
  • Burkard TR. et al., 2011, BMC Syst Biol. 5:17.
  • Size / Price
    Каталог: MG50374-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.