After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SERPINB1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_173052.2
Размер кДНК:1149bp
Описание кДНК:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 1b with N terminal HA tag.
Синоним гена:EIB, Serpin1b1, ovalbumin, 6330533H24Rik
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51991-ACGRBS15396
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51991-ACRRBS15396
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51991-ANGRBS15396
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51991-ANRRBS15396
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51991-CFRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51991-CHRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51991-CMRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51991-CYRBS13343
Мышь SERPINB1B Джин клон кДНК в вектор клонированияMG51991-GRBS5132
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51991-NFRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51991-NHRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51991-NMRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51991-NYRBS13343
Мышь SERPINB1B Джин ORF экспрессии кДНК клона плазмидыMG51991-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51991-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».