Быстрый заказ

Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь SERPINA3N Информация о продукте «Клон cDNA»
Размер кДНК:1257bp
Описание кДНК:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3N with C terminal HA tag.
Синоним гена:Spi2-2, Spi2.2, Spi2/eb.4, Serpina3n
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with Serpina3n qPCR primers for gene expression analysis, MP200510 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50518-ACGRBS15400
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50518-ACRRBS15400
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50518-CFRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50518-CHRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50518-CMRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50518-CYRBS13340
Мышь Serpina3n Джин клон кДНК в вектор клонированияMG50518-MRBS5130
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50518-NFRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50518-NHRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50518-NMRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50518-NYRBS13340
Мышь Serpina3n Джин ORF экспрессии кДНК клона плазмидыMG50518-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50518-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.