Быстрый заказ

Text Size:AAA

Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SELP Информация о продукте «Клон cDNA»
Размер кДНК:2307bp
Описание кДНК:Full length Clone DNA of Mus musculus selectin, platelet with N terminal His tag.
Синоним гена:Grmp, CD62P, PADGEM, MGC129336, MGC129337, P-selectin, Selp
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50737-ACGRBS16760
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50737-ACRRBS16760
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50737-CFRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50737-CHRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50737-CMRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50737-CYRBS14710
Мышь P-Selectin/CD62P/SELP Джин клон кДНК в вектор клонированияMG50737-GRBS5130
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50737-NFRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50737-NHRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50737-NMRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50737-NYRBS14710
Мышь P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмидыMG50737-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

P selectin (SELP) is a 140kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. SELP mediates rapid rolling of leukocyte rolling over vascular surfaces during the initial steps in inflammation through interaction with PSGL1. P selectin is a cell adhesion molecule on the surface of activated endothelial cells. Cellular adhesion molecules are a large family of proteins that attach the cytoskeleton and intracellular signaling cascades with the extracellular environment. SELP is a calcium-dependent receptor for myeloid cells that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interacton of activated endothelial cells or platelets with leukocytes.

  • Johnson-Tidey RR, et al. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol. 144(5):952-61.
  • Walcheck B, et al. (1996) Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocyte accumulation of P-selectin in vitro. J Clin Invest. 98(5):1081-7.
  • Foreman KE, et al. (1994) C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 94(3):1147-55.
  • Size / Price
    Каталог: MG50737-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.