Быстрый заказ

Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SELENBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009150.3
Размер кДНК:1419bp
Описание кДНК:Full length Clone DNA of Mus musculus selenium binding protein 1.
Синоним гена:Lp56, Lpsb, SBP56
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51365-ACGRBS15400
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51365-ACRRBS15400
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51365-ANGRBS15400
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51365-ANRRBS15400
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51365-CFRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51365-CHRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51365-CMRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51365-CYRBS13340
Мышь SELENBP1 Джин клон кДНК в вектор клонированияMG51365-GRBS5130
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51365-NFRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51365-NHRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51365-NMRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51365-NYRBS13340
Мышь SELENBP1 Джин ORF экспрессии кДНК клона плазмидыMG51365-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51365-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».