Быстрый заказ

Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SELE Информация о продукте «Клон cDNA»
Размер кДНК:1860bp
Описание кДНК:Full length Clone DNA of Mus musculus selectin, endothelial cell with N terminal His tag.
Синоним гена:Elam, CD62E, E-selectin, Sele
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50736-ACGRBS16764
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50736-ACRRBS16764
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50736-CFRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50736-CHRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50736-CMRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50736-CYRBS14711
Мышь E-Selectin/CD62e/SELE Джин клон кДНК в вектор клонированияMG50736-GRBS5132
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50736-NFRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50736-NHRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50736-NMRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50736-NYRBS14711
Мышь E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмидыMG50736-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name

E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that is expressed on the surfaces of stimulated vascular endothelial cells and is sometimes involved in cancer cell metastasis. E-selectin exhibits a complex mosaic structure consisting of a large extracellular region comprised of a lectin domain, an EGF-like domain, and a short consensus repeat (SCR) domain, followed by a transmembrane region and a relatively short (32 aa) cytoplasmic tail. As a member of the LEC-CAM or selectin family, E-selectin recognises and binds to sialylated carbohydrates including members of the Lewis X and Lewis A families found on monocytes, granulocytes, and T-lymphocytes. E-selectin supports rolling and stable arrest of leukocytes on activated vascular endothelium, and furthermore, it was indicated that it can also transduce an activating stimulus via the MAPK cascade into the endothelial cell during leukocyte adhesion. E-selectin regulates adhesive interactions between certain blood cells and endothelium. The soluble form of E selectin (sE-selectin) is a marker of endothelial activation, and has a potential role in the pathogenesis of cardiovascular disease as raised levels have been found in hypertension, diabetes and hyperlipidemia, although its association in established atherosclerosis disease and its value as a prognostic factor is more controversial. soluble E-selectin is inversely associated with the muscular component of the left ventricle, thereby suggesting that the lack of such a reparative factor may be associated with cardiac remodeling in end-stage renal disease (ESRD) patients. In addition, this adhesion molecule appears to be involved in the pathogenesis of atherosclerosis.

  • Roldn V, et al. (2003) Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb Haemost. 90(6): 1007-20.
  • Kawase J, et al. (2009) Increase in E-selectin expression in umbilical vein endothelial cells by anticancer drugs and inhibition by cimetidine. Oncol Rep. 22(6): 1293-7.
  • Matsumoto K, et al. (2010) Soluble adhesion molecule E-selectin predicts cardiovascular events in Japanese patients with type 2 diabetes mellitus. Metabolism. 59(3): 320-4.
  • Stancanelli B, et al. (2010) Soluble e-selectin is an inverse and independent predictor of left ventricular wall thickness in end-stage renal disease patients. Nephron Clin Pract. 114(1): c74-80.
  • Size / Price
    Каталог: MG50736-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.