After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SDHAF2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025333.4
Размер кДНК:495bp
Описание кДНК:Full length Clone DNA of Mus musculus succinate dehydrogenase complex assembly factor 2.
Синоним гена:AA407634, AW049997, 0610038F07Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52467-ACGRBS15400
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52467-ACRRBS15400
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52467-ANGRBS15400
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52467-ANRRBS15400
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52467-CFRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52467-CHRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52467-CMRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52467-CYRBS13340
Мышь SDHAF2 Джин клон кДНК в вектор клонированияMG52467-GRBS5130
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52467-NFRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52467-NHRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52467-NMRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52467-NYRBS13340
Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмидыMG52467-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52467-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».