Быстрый заказ

Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SDHAF2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_025333.4
    Размер кДНК:495bp
    Описание кДНК:Full length Clone DNA of Mus musculus succinate dehydrogenase complex assembly factor 2.
    Синоним гена:AA407634, AW049997, 0610038F07Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SDHAF2 qPCR primers for gene expression analysis, MP202340 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52467-ACGRBS15400
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52467-ACRRBS15400
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52467-ANGRBS15400
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52467-ANRRBS15400
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52467-CFRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52467-CHRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52467-CMRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52467-CYRBS13340
    Мышь SDHAF2 Джин клон кДНК в вектор клонированияMG52467-GRBS5130
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52467-NFRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52467-NHRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52467-NMRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52467-NYRBS13340
    Мышь SDHAF2 Джин ORF экспрессии кДНК клона плазмидыMG52467-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52467-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».