Быстрый заказ

Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SDC4 Информация о продукте «Клон cDNA»
Размер кДНК:597bp
Описание кДНК:Full length Clone DNA of Mus musculus syndecan 4 with N terminal His tag.
Синоним гена:Synd4, AA959608, AW108331, ryudocan, syndecan-4, Sdc4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50726-ACGRBS15400
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50726-ACRRBS15400
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50726-CFRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50726-CHRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50726-CMRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50726-CYRBS13340
Мышь Syndecan-4/SDC4 Джин клон кДНК в вектор клонированияMG50726-GRBS5130
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50726-NFRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50726-NHRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50726-NMRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50726-NYRBS13340
Мышь Syndecan-4/SDC4 Джин ORF экспрессии кДНК клона плазмидыMG50726-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SDC4 (Syndecan-4), also known as Syn4, is a transmembrane heparan sulfate proteoglycan that co-operates with integrins during cell-matrix interactions for the assembly of focal adhesions and actin stress fibers and in the phosphorylation of focal adhesion kinase (FAK) on Tyr397. Syndecan-4 plays roles in the formation of focal adhesions and stress fibers. The cytoplasmic domain of syndecan-4 interacts with a number of signalling and structural proteins, and both extracellular and cytoplasmic domains are necessary for regulated activation of associated transmembrane receptors. Syndecan-4/SDC4 is a heparan sulfate proteoglycan and works as a coreceptor for various growth factors. SDC4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cells (VSMCs) proliferation and vascular progenitor cells (VPCs) mobilization. Therefore, SDC4 may be a novel therapeutic target for preventing arterial restenosis after angioplasty.

  • Ikesue M, et al. (2011) Syndecan-4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cell proliferation and vascular progenitor cell mobilization. Arterioscler Thromb Vasc Biol. 31(5): 1066-74.
  • Saoncella S, et al. (2004) Syndecan-4 regulates ATF-2 transcriptional activity in a Rac1-dependent manner. J Biol Chem. 279(45): 47172-6.
  • Bass MD, et al. (2002) Cytoplasmic interactions of syndecan-4 orchestrate adhesion receptor and growth factor receptor signalling. Biochem J. 368(Pt 1): 1-15.
  • Couchman JR, et al. (1999) Syndecan-4 and integrins: combinatorial signaling in cell adhesion. J Cell Sci. 112 ( Pt 20): 3415-20.
  • Size / Price
    Каталог: MG50726-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.