Быстрый заказ

Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SCMH1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_013883.2
    Размер кДНК:1995bp
    Описание кДНК:Full length Clone DNA of Mus musculus sex comb on midleg homolog 1 with C terminal His tag.
    Синоним гена:Scml1, Scml3, AI315320, AI851618
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SCMH1 qPCR primers for gene expression analysis, MP201589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51716-ACGRBS16760
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51716-ACRRBS16760
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51716-ANGRBS16760
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51716-ANRRBS16760
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51716-CFRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51716-CHRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51716-CMRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51716-CYRBS14710
    Мышь SCMH1 Джин клон кДНК в вектор клонированияMG51716-GRBS5130
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51716-NFRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51716-NHRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51716-NMRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51716-NYRBS14710
    Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмидыMG51716-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51716-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».