Быстрый заказ

Text Size:AAA

Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SCMH1 Информация о продукте «Клон cDNA»
Размер кДНК:1995bp
Описание кДНК:Full length Clone DNA of Mus musculus sex comb on midleg homolog 1 with C terminal His tag.
Синоним гена:Scml1, Scml3, AI315320, AI851618
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51716-ACGRBS16760
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51716-ACRRBS16760
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51716-ANGRBS16760
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51716-ANRRBS16760
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51716-CFRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51716-CHRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51716-CMRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51716-CYRBS14710
Мышь SCMH1 Джин клон кДНК в вектор клонированияMG51716-GRBS5130
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51716-NFRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51716-NHRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51716-NMRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51716-NYRBS14710
Мышь SCMH1 Джин ORF экспрессии кДНК клона плазмидыMG51716-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51716-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.