After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SCARB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016741.1
Размер кДНК:1530bp
Описание кДНК:Full length Clone DNA of Mus musculus scavenger receptor class B, member 1 with C terminal Myc tag.
Синоним гена:CD36, Cla1, SRBI, Srb1, Cla-1, SR-B1, SR-BI, Cd36l1, mSR-BI, AI120173, D5Ertd460e, Scarb1
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:pCMV3-mSCARB1-Myc
Участок рестрикции:KpnI + XbaI (6kb + 1.58kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SCARB1 Gene Plasmid Map
Mouse SCARB1 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50317-ACGRBS16760
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50317-ACRRBS16760
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50317-ANGRBS16760
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50317-CFRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50317-CHRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50317-CMRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50317-CYRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин клон кДНК в вектор клонированияMG50317-MRBS5130
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50317-NFRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50317-NHRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50317-NMRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50317-NYRBS14710
Мышь SR-BI/SCARB1/CD36L1 Джин ORF экспрессии кДНК клона плазмидыMG50317-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway. High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.

Ссылки
  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 
  • Size / Price
    Каталог: MG50317-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse SCARB1 natural ORF mammalian expression plasmid, C-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».