After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse S100A9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009114.2
Размер кДНК:342bp
Описание кДНК:Full length Clone DNA of Mus musculus S100 calcium binding protein A9 (calgranulin B).
Синоним гена:p14, Cagb, GAGB, L1Ag, BEE22, MRP14, 60B8Ag, AW546964, S100a9
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:pCMV3-mS100A9
Участок рестрикции:KpnI + XbaI (6.1kb + 0.34kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse S100A9 Gene Plasmid Map
Mouse S100A9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50284-ACGRBS15400
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50284-ACRRBS15400
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50284-CFRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50284-CHRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50284-CMRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50284-CYRBS13340
Мышь S100A9/MRP-14 Джин клон кДНК в вектор клонированияMG50284-MRBS5130
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50284-NFRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50284-NHRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50284-NMRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50284-NYRBS13340
Мышь S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмидыMG50284-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A9, also known as S100 calcium-binding protein A9, S100A9, and CAGB, is a member of the S-100 family. S100A9 is expressed by macrophages in acutely inflammed tissues and in chronic inflammation. It is also expressed in epithelial cells constitutively or induced during dermatoses. S100A9 is a calcium-binding protein. It has anti-microbial activity towards bacteria and fungi. The anti-microbial and proapoptotic activity of S100A9 is inhibited by zinc ions. S100A9 plays a role in the development of endotoxic shock in response to bacterial lipopolysaccharide (LPS). It promotes tubulin polymerization when unphosphorylated. It also promotes phagocyte migration and infiltration of granulocytes at sites of wounding. S100A9 plays a role as a pro-inflammatory mediator in acute and chronic inflammation and up-regulates the release of IL8 and cell-surface expression of ICAM1.

Ссылки
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Fanò G. et al., 1995, Prog Neurobiol. 46 (1): 71-82.
  • Vogl T. et al., 2004, Blood. 104: 4260-8.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Каталог: MG50284-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse S100A9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».