Быстрый заказ

Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse S100A13 Информация о продукте «Клон cDNA»
Размер кДНК:297bp
Описание кДНК:Full length Clone DNA of Mus musculus S100 calcium binding protein A13 with N terminal Myc tag.
Синоним гена:S100a13
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50207-ACGRBS15400
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50207-ACRRBS15400
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50207-ANGRBS15400
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50207-ANRRBS15400
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50207-CFRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50207-CHRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50207-CMRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50207-CYRBS13340
Мышь S100A13 Джин клон кДНК в вектор клонированияMG50207-MRBS5130
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50207-NFRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50207-NHRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50207-NMRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50207-NYRBS13340
Мышь S100A13 Джин ORF экспрессии кДНК клона плазмидыMG50207-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  Protein S100-A13, also known as S100 calcium-binding protein A13, is a member of the S-100 family. It contains two EF-hand domains. S100A13 binds two calcium ions per subunit and one copper ion. Binding of one copper ion does not interfere with calcium binding. S100A13 is required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine. S100A13 plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway.

  • Mandinova A. et al., 2003, J Cell Sci. 116: 2687-96.
  • Arnesano F. et al., 2005, Angew Chem Int Ed. 44: 6341-4.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Каталог: MG50207-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.