Быстрый заказ

Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RSPO2 Информация о продукте «Клон cDNA»
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Mus musculus R-spondin 2 homolog with N terminal Flag tag.
Синоним гена:ftls, AA673245
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51078-ACGRBS15400
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51078-ACRRBS15400
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51078-CFRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51078-CHRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51078-CMRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51078-CYRBS13340
Мышь FTLS / RSPO2 Джин клон кДНК в вектор клонированияMG51078-GRBS5130
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51078-NFRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51078-NHRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51078-NMRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51078-NYRBS13340
Мышь FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмидыMG51078-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • Size / Price
    Каталог: MG51078-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.