After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RAF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_029780.3
Размер кДНК:1947bp
Описание кДНК:Full length Clone DNA of Mus musculus v-raf-leukemia viral oncogene 1.
Синоним гена:Apn, Cd13, Lap-1, Lap1, p150
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50287-ACGRBS16760
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50287-ACRRBS16760
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50287-CFRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50287-CHRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50287-CMRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50287-CYRBS14710
Мышь Raf-1/RAF1 Джин клон кДНК в вектор клонированияMG50287-MRBS5130
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50287-NFRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50287-NHRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50287-NMRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50287-NYRBS14710
Мышь Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмидыMG50287-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50287-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».