RPS18 cDNA ORF Clone, Mouse, untagged

Cat: MG51326-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPS18 Reagents
CRO Services
Product recommended

All RPS18 Reagents
RPS18 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Mouse ribosomal protein S18.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS18 cDNA ORF Clone, Mouse, untagged Alternative Names
H-2Ke3 cDNA ORF Clone, Mouse;H2-Ke3 cDNA ORF Clone, Mouse;Ke-3 cDNA ORF Clone, Mouse;ke3 cDNA ORF Clone, Mouse
RPS18 Background Information
Full Name
ribosomal protein S18

RPS18 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS18 cDNA ORF Clone in Cloning Vector, Rat RG80782-U
RPS18 cDNA ORF Clone, Rat, untagged RG80782-UT
RPS18 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80782-ACGLN
RPS18 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80782-ACG
RPS18 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80782-ANG
RPS18 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80782-ACR
RPS18 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80782-ANR
RPS18 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80782-CF
RPS18 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80782-NF
RPS18 cDNA ORF Clone, Rat, C-His tag RG80782-CH
RPS18 cDNA ORF Clone, Rat, N-His tag RG80782-NH
RPS18 cDNA ORF Clone, Rat, C-HA tag RG80782-CY
RPS18 cDNA ORF Clone, Rat, N-HA tag RG80782-NY
RPS18 cDNA ORF Clone, Rat, C-Myc tag RG80782-CM
RPS18 cDNA ORF Clone, Rat, N-Myc tag RG80782-NM
RPS18 qPCR Primer Pairs, Rat RP300746

RPS18 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS18 cDNA ORF Clone in Cloning Vector, Mouse MG51326-U
RPS18 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51326-ACGLN
RPS18 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51326-ACG
RPS18 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51326-ANG
RPS18 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51326-ACR
RPS18 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51326-ANR
RPS18 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51326-CF
RPS18 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51326-NF
RPS18 cDNA ORF Clone, Mouse, C-His tag MG51326-CH
RPS18 cDNA ORF Clone, Mouse, N-His tag MG51326-NH
RPS18 cDNA ORF Clone, Mouse, C-HA tag MG51326-CY
RPS18 cDNA ORF Clone, Mouse, N-HA tag MG51326-NY
RPS18 cDNA ORF Clone, Mouse, C-Myc tag MG51326-CM
RPS18 cDNA ORF Clone, Mouse, N-Myc tag MG51326-NM
RPS18 qPCR Primer Pairs, Mouse MP201203

RPS18 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS18 cDNA ORF Clone in Cloning Vector, Human HG20477-U
RPS18 cDNA ORF Clone, Human, untagged HG20477-UT
RPS18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20477-ACGLN
RPS18 cDNA ORF Clone, Human, C-GFPSpark® tag HG20477-ACG
RPS18 cDNA ORF Clone, Human, N-GFPSpark® tag HG20477-ANG
RPS18 cDNA ORF Clone, Human, C-OFPSpark® tag HG20477-ACR
RPS18 cDNA ORF Clone, Human, N-OFPSpark® tag HG20477-ANR
RPS18 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20477-CF
RPS18 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20477-NF
RPS18 cDNA ORF Clone, Human, C-His tag HG20477-CH
RPS18 cDNA ORF Clone, Human, N-His tag HG20477-NH
RPS18 cDNA ORF Clone, Human, C-HA tag HG20477-CY
RPS18 cDNA ORF Clone, Human, N-HA tag HG20477-NY
RPS18 cDNA ORF Clone, Human, C-Myc tag HG20477-CM
RPS18 cDNA ORF Clone, Human, N-Myc tag HG20477-NM
info info
添加购物车成功! 添加购物车失败!