Быстрый заказ

Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RPS18 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:AK146354.1
    Размер кДНК:459bp
    Описание кДНК:Full length Clone DNA of Mus musculus ribosomal protein S18.
    Синоним гена:ke3, Ke-3, H-2Ke3, H2-Ke3
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPS18 qPCR primers for gene expression analysis, MP201203 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51326-ACGRBS15400
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51326-ACRRBS15400
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51326-ANGRBS15400
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51326-ANRRBS15400
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51326-CFRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51326-CHRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51326-CMRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51326-CYRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51326-NFRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51326-NHRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51326-NMRBS13340
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51326-NYRBS13340
    Мышь RPS18 Джин клон кДНК в вектор клонированияMG51326-URBS5130
    Мышь RPS18 Джин ORF экспрессии кДНК клона плазмидыMG51326-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51326-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».