After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RPS18 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK146354.1
Размер кДНК:459bp
Описание кДНК:Full length Clone DNA of Mus musculus ribosomal protein S18.
Синоним гена:ke3, Ke-3, H-2Ke3, H2-Ke3
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51326-ACGRBS15400
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51326-ACRRBS15400
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51326-ANGRBS15400
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51326-ANRRBS15400
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51326-CFRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51326-CHRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51326-CMRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51326-CYRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51326-NFRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51326-NHRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51326-NMRBS13340
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51326-NYRBS13340
Мышь RPS18 Джин клон кДНК в вектор клонированияMG51326-URBS5130
Мышь RPS18 Джин ORF экспрессии кДНК клона плазмидыMG51326-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51326-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».