Быстрый заказ

Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RPS14 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK168237.1
Размер кДНК:456bp
Описание кДНК:Full length Clone DNA of Mus musculus ribosomal protein S14.
Синоним гена:AL023078, 2600014J02Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51360-ACGRBS15396
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51360-ACRRBS15396
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51360-ANGRBS15396
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51360-ANRRBS15396
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51360-CFRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51360-CHRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51360-CMRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51360-CYRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51360-NFRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51360-NHRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51360-NMRBS13343
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51360-NYRBS13343
Мышь RPS14 Джин клон кДНК в вектор клонированияMG51360-URBS5132
Мышь RPS14 Джин ORF экспрессии кДНК клона плазмидыMG51360-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51360-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».