Быстрый заказ

Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RPL8 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_012053.2
    Размер кДНК:774bp
    Описание кДНК:Full length Clone DNA of Mus musculus ribosomal protein L8.
    Синоним гена:Rpl8
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPL8 qPCR primers for gene expression analysis, MP202336 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52463-ACGRBS15400
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52463-ACRRBS15400
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52463-ANGRBS15400
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52463-ANRRBS15400
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52463-CFRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52463-CHRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52463-CMRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52463-CYRBS13340
    Мышь RPL8 Джин клон кДНК в вектор клонированияMG52463-GRBS5130
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52463-NFRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52463-NHRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52463-NMRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52463-NYRBS13340
    Мышь RPL8 Джин ORF экспрессии кДНК клона плазмидыMG52463-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».