After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RPL8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012053.2
Размер кДНК:774bp
Описание кДНК:Full length Clone DNA of Mus musculus ribosomal protein L8.
Синоним гена:Rpl8
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52463-ACGRBS15400
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52463-ACRRBS15396
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52463-ANGRBS15400
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52463-ANRRBS15396
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52463-CFRBS13340
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52463-CHRBS13340
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52463-CMRBS13343
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52463-CYRBS13340
Мышь RPL8 Джин клон кДНК в вектор клонированияMG52463-GRBS5132
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52463-NFRBS13343
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52463-NHRBS13340
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52463-NMRBS13343
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52463-NYRBS13340
Мышь RPL8 Джин ORF экспрессии кДНК клона плазмидыMG52463-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52463-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».