Быстрый заказ

Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RPL29 Информация о продукте «Клон cDNA»
Размер кДНК:483bp
Описание кДНК:Full length Clone DNA of Mus musculus ribosomal protein L29 with N terminal His tag.
Синоним гена:Rpl43
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52530-ACGRBS15400
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52530-ACRRBS15400
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52530-ANGRBS15400
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52530-ANRRBS15400
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52530-CFRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52530-CHRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52530-CMRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52530-CYRBS13340
Мышь RPL29 Джин клон кДНК в вектор клонированияMG52530-GRBS5130
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52530-NFRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52530-NHRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52530-NMRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52530-NYRBS13340
Мышь RPL29 Джин ORF экспрессии кДНК клона плазмидыMG52530-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52530-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.