After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ROBO4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ROBO4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_028783.2
Размер кДНК:3048bp
Описание кДНК:Full length Clone DNA of Mus musculus roundabout homolog 4 (Drosophila) with C terminal His tag.
Синоним гена:AI593217, 1200012D01Rik, Robo4
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ROBO4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Product nameProduct name
Фон

Roundabout homolog 4, also known as magic roundabout and ROBO4 is a member of the immunoglobulin superfamily and ROBO family. ROBO4 is specifically expressed in endothelial cells. It is expressed at sites of angiogenesis in different tumor types. ROBO4 contains two fibronectin type-III domains and two Ig-like C2-type (immunoglobulin-like) domains. ROBO4 is the fourth identified member of the roundabout receptor family. It is the only Robo family member expressed in primary endothelial cells and that application of Slit inhibits their migration. ROBO4 is predominantly expressed in embryonic or tumor vascular endothelium and is considered important for vascular development and as a candidate tumor endothelial marker. ROBO4 is a bona fide member of the Robo family and may provide a repulsive cue to migrating endothelial cells during vascular development. ROBO4 is a receptor for Slit proteins, at least for SLIT2, and seems to be involved in angiogenesis and vascular patterning. ROBO4 may mediate the inhibition of primary endothelial cell migration by Slit proteins. Activating ROBO4 may have broad therapeutic application in diseases characterized by excessive angiogenesis and/or vascular leak.

Ссылки
  • Huminiecki L., et al., 2002, Genomics 79:547-552.
  • Park,K.W. et al., 2003,Dev Biol. 261 (1):251-67.
  • Yoshikawa,M. et al., 2008, Protein Expr Purif. 61 (1):78-82.
  • Jones,C.A. et al., 2008, Nat Med. 14 (4):448-53.
  • Koch,A.W. et al., 2011, Dev Cell. 20 (1):33-46.
  • Size / Price
    Каталог: MG51081-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».