Быстрый заказ

Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь RNGTT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011884.2
Размер кДНК:1794bp
Описание кДНК:Full length Clone DNA of Mus musculus RNA guanylyltransferase and 5'-phosphatase with C terminal His tag.
Синоним гена:AU020997
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53041-ACGRBS16760
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53041-ACRRBS16760
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53041-ANGRBS16760
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53041-ANRRBS16760
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53041-CFRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53041-CHRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53041-CMRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53041-CYRBS14710
Мышь RNGTT Джин клон кДНК в вектор клонированияMG53041-GRBS5130
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53041-NFRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53041-NHRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53041-NMRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53041-NYRBS14710
Мышь RNGTT Джин ORF экспрессии кДНК клона плазмидыMG53041-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG53041-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».