Быстрый заказ

Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь RNFT1 Информация о продукте «Клон cDNA»
Размер кДНК:1188 bp
Описание кДНК:Full length Clone DNA of Mus musculus ring finger protein, transmembrane 1
Синоним гена:0610013E23Rik,AV007605
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with RNFT1 qPCR primers for gene expression analysis, MP202606 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52735-ACGRBS15400
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52735-ACRRBS15400
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52735-ANGRBS15400
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52735-ANRRBS15400
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52735-CFRBS13340
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52735-CHRBS13340
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52735-CMRBS13340
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52735-CYRBS13340
Mouse RNFT1 Gene cDNA clone plasmidMG52735-GRBS5130
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52735-NFRBS13340
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52735-NHRBS13340
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52735-NMRBS13340
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52735-NYRBS13340
Мышь RNFT1 Джин клон кДНК в вектор клонированияMG52735-URBS5130
Мышь RNFT1 Джин ORF экспрессии кДНК клона плазмидыMG52735-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52735-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.