After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RNF167 Информация о продукте «Клон cDNA»
Размер кДНК:1044bp
Описание кДНК:Full length Clone DNA of Mus musculus ring finger protein 167 with N terminal His tag.
Синоним гена:AU019305, AV328608, RP23-326P7.8, 0610010G05Rik, 5730408C10Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51409-ACGRBS15400
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51409-ACRRBS15400
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51409-CFRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51409-CHRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51409-CMRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51409-CYRBS13340
Мышь RNF167 Джин клон кДНК в вектор клонированияMG51409-GRBS5130
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51409-NFRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51409-NHRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51409-NMRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51409-NYRBS13340
Мышь RNF167 Джин ORF экспрессии кДНК клона плазмидыMG51409-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51409-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.