Быстрый заказ

Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RNF114 Информация о продукте «Клон cDNA»
Размер кДНК:690bp
Описание кДНК:Full length Clone DNA of Mus musculus ring finger protein 114 with C terminal His tag.
Синоним гена:Zfp228, Zfp313, Znf228, AI225886, AW549494, 1110008J21Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53035-ACGRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53035-ACRRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53035-ANGRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53035-ANRRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53035-CFRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53035-CHRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53035-CMRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53035-CYRBS13340
Мышь RNF114 Джин клон кДНК в вектор клонированияMG53035-GRBS5130
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53035-NFRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53035-NHRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53035-NMRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53035-NYRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмидыMG53035-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG53035-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.