After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RNF114 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_030743.5
Размер кДНК:690bp
Описание кДНК:Full length Clone DNA of Mus musculus ring finger protein 114 with C terminal His tag.
Синоним гена:Zfp228, Zfp313, Znf228, AI225886, AW549494, 1110008J21Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53035-ACGRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53035-ACRRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53035-ANGRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53035-ANRRBS15400
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53035-CFRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53035-CHRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53035-CMRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53035-CYRBS13340
Мышь RNF114 Джин клон кДНК в вектор клонированияMG53035-GRBS5130
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53035-NFRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53035-NHRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53035-NMRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53035-NYRBS13340
Мышь RNF114 Джин ORF экспрессии кДНК клона плазмидыMG53035-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG53035-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».