Быстрый заказ

Text Size:AAA

Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RLIM Информация о продукте «Клон cDNA»
Размер кДНК:1803bp
Описание кДНК:Full length Clone DNA of Mus musculus ring finger protein, LIM domain interacting with C terminal Myc tag.
Синоним гена:Ha1r, Rnf12, AL022832, AW743871
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51610-ACGRBS16764
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51610-ACRRBS16764
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51610-ANGRBS16764
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51610-ANRRBS16764
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51610-CFRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51610-CHRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51610-CMRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51610-CYRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51610-NFRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51610-NHRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51610-NMRBS14711
Мышь RLIM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51610-NYRBS14711
Мышь RLIM Джин клон кДНК в вектор клонированияMG51610-URBS5132
Мышь RLIM Джин ORF экспрессии кДНК клона плазмидыMG51610-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51610-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.