RIP3 / RIPK3 cDNA ORF Clone, Mouse, C-His tag

1/1
Price:
Size:
Number:

RIP3 / RIPK3 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse receptor-interacting serine-threonine kinase 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.51kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RIP3 / RIPK3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RIP3 / RIPK3 cDNA ORF Clone, Mouse, C-His tag: Validated Images

RIP3 / RIPK3 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

2610528K09Rik cDNA ORF Clone, Mouse; AW107945 cDNA ORF Clone, Mouse; Rip3 cDNA ORF Clone, Mouse

RIP3 / RIPK3 Background Information

Necroptosis is a form of programmed necrotic cell death that is rapidly emerging as an important pathophysiological pathway in numerous disease states. Necroptosis is dependent on receptor-interacting protein kinase 3 (RIPK3), a protein shown to play an important role in experimental models of critical illness. RIPK3 promotes kidney tubular injury via mitochondrial dysfunction. The FAO-dependent RIPK3 mediates pathogenesis of acute lung injury.
Full Name
receptor-interacting serine-threonine kinase 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait