Быстрый заказ

Text Size:AAA

Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RIPK3 Информация о продукте «Клон cDNA»
Размер кДНК:1461bp
Описание кДНК:Full length Clone DNA of Mus musculus receptor-interacting serine-threonine kinase 3 with N terminal Flag tag.
Синоним гена:Rip3, AW107945, 2610528K09Rik
Участок рестрикции:KpnI + XbaI (6kb + 1.51kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse RIPK3 Gene Plasmid Map
Mouse RIPK3 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51069-ACGRBS15396
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51069-ACRRBS15396
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51069-ANGRBS15396
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51069-ANRRBS15396
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51069-CFRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51069-CHRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51069-CMRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51069-CYRBS13343
Мышь RIPK3 Джин клон кДНК в вектор клонированияMG51069-GRBS5132
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмидыMG51069-G-NRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51069-NFRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51069-NHRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51069-NMRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51069-NYRBS13343
Мышь RIPK3 Джин ORF экспрессии кДНК клона плазмидыMG51069-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51069-NF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human CDC25A ORF mammalian expression plasmid, C-Flag tag
  • Mouse RIPK3 natural ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.