After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RHOA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016802.4
Размер кДНК:582bp
Описание кДНК:Full length Clone DNA of Mus musculus ras homolog gene family, member A with N terminal Myc tag.
Синоним гена:Arha; Arha1; Arha2
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52590-ACGRBS15400
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52590-ACRRBS15400
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52590-ANGRBS15400
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52590-ANRRBS15400
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52590-CFRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52590-CHRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52590-CMRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52590-CYRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52590-NFRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52590-NHRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52590-NMRBS13340
Мышь RhoA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52590-NYRBS13340
Мышь RhoA Джин клон кДНК в вектор клонированияMG52590-URBS5130
Мышь RhoA Джин ORF экспрессии кДНК клона плазмидыMG52590-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.

Ссылки
  • Kiss C, et al.,1997, Cytogenet. Cell Genet. 79 (3-4): 228-30.
  • Anastasiadis,P.Z. et al., 2000, Nat Cell Biol. 2 (9):637-44.
  • Yiu G, et al.,2006, Nat. Rev. Neurosci. 7 (8): 617-27.
  • Wang,HR. et al., 2006, Methods Enzymol. 406 :437-47.
  • Heo,J. et al., 2006, Biochemistry. 45 (48):14481-9.
  • Size / Price
    Каталог: MG52590-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».