Быстрый заказ

Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RGS7BP Информация о продукте «Клон cDNA»
    Размер кДНК:774bp
    Описание кДНК:Full length Clone DNA of Mus musculus regulator of G-protein signalling 7 binding protein with N terminal His tag.
    Синоним гена:R7bp, AI842293, D13Bwg1146e, A930030I01Rik
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with RGS7BP qPCR primers for gene expression analysis, MP201835 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51962-ACGRBS15400
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51962-ACRRBS15400
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51962-ANGRBS15400
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51962-ANRRBS15400
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51962-CFRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51962-CHRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51962-CMRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51962-CYRBS13340
    Мышь RGS7BP Джин клон кДНК в вектор клонированияMG51962-GRBS5130
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51962-NFRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51962-NHRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51962-NMRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51962-NYRBS13340
    Мышь RGS7BP Джин ORF экспрессии кДНК клона плазмидыMG51962-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51962-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.