After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RGS14 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016758.3
Размер кДНК:1644bp
Описание кДНК:Full length Clone DNA of Mus musculus regulator of G-protein signaling 14.
Синоним гена:RPIP1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52451-ACGRBS16760
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52451-ACRRBS16760
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52451-ANGRBS16760
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52451-ANRRBS16760
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52451-CFRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52451-CHRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52451-CMRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52451-CYRBS14710
Мышь RGS14 Джин клон кДНК в вектор клонированияMG52451-GRBS5130
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52451-NFRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52451-NHRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52451-NMRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52451-NYRBS14710
Мышь RGS14 Джин ORF экспрессии кДНК клона плазмидыMG52451-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52451-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».