Быстрый заказ

Мышь REG3D Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь REG3D Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_013893.2
    Размер кДНК:528bp
    Описание кДНК:Full length Clone DNA of Mus musculus regenerating islet-derived 3 delta with N terminal HA tag.
    Синоним гена:Ingaprp, MGC130575, Reg3d
    Виды:Mouse
    переносчик:pCMV3-SP-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REG3D qPCR primers for gene expression analysis, MP200532 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь REG3D Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Product nameProduct name
    Фон

    Regenerating islet-derived 3 delta (REG3D) is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids.

    Ссылки
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727 (3): 177-87.
  • Hillier LW, et al. (2005) Generation and annotation of the DNA sequences of human chromosomes 2 and 4. Nature 434 (7034): 724-31.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Каталог: MG50540-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».