Быстрый заказ

Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RCAN1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_019466.3
    Размер кДНК:597bp
    Описание кДНК:Full length Clone DNA of Mus musculus regulator of calcineurin 1.
    Синоним гена:CSP1, DSC1, RCN1, Dscr1, MCIP1, CALP1L, Adapt78, AA408855, AI429645, AL024459, AV028423, 2410048A02Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RCAN1 qPCR primers for gene expression analysis, MP201250 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51377-ACGRBS15400
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51377-ACRRBS15400
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51377-ANGRBS15400
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51377-ANRRBS15400
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51377-CFRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51377-CHRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51377-CMRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51377-CYRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51377-NFRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51377-NHRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51377-NMRBS13340
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51377-NYRBS13340
    Мышь RCAN1 Джин клон кДНК в вектор клонированияMG51377-URBS5130
    Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмидыMG51377-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51377-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».