After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RCAN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019466.3
Размер кДНК:597bp
Описание кДНК:Full length Clone DNA of Mus musculus regulator of calcineurin 1.
Синоним гена:CSP1, DSC1, RCN1, Dscr1, MCIP1, CALP1L, Adapt78, AA408855, AI429645, AL024459, AV028423, 2410048A02Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51377-ACGRBS15400
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51377-ACRRBS15400
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51377-ANGRBS15400
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51377-ANRRBS15400
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51377-CFRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51377-CHRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51377-CMRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51377-CYRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51377-NFRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51377-NHRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51377-NMRBS13340
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51377-NYRBS13340
Мышь RCAN1 Джин клон кДНК в вектор клонированияMG51377-URBS5130
Мышь RCAN1 Джин ORF экспрессии кДНК клона плазмидыMG51377-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51377-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».