RBX1 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

RBX1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
327 bp
Description
Full length Clone DNA of Mouse ring-box 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RBX1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

1500002P15Rik cDNA ORF Clone, Mouse; AA517855 cDNA ORF Clone, Mouse; ROC1 cDNA ORF Clone, Mouse

RBX1 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait