Быстрый заказ

Text Size:AAA

Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RBX1 Информация о продукте «Клон cDNA»
Размер кДНК:327bp
Описание кДНК:Full length Clone DNA of Mus musculus ring-box 1 with C terminal Myc tag.
Синоним гена:ROC1, AA517855, 1500002P15Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51611-ACGRBS15400
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51611-ACRRBS15400
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51611-ANGRBS15400
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51611-ANRRBS15400
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51611-CFRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51611-CHRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51611-CMRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51611-CYRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51611-NFRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51611-NHRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51611-NMRBS13340
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51611-NYRBS13340
Мышь RBX1 Джин клон кДНК в вектор клонированияMG51611-URBS5130
Мышь RBX1 Джин ORF экспрессии кДНК клона плазмидыMG51611-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51611-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.