After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RBM10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001167776.1
Размер кДНК:2562bp
Описание кДНК:Full length Clone DNA of Mus musculus RNA binding motif protein 10 with C terminal His tag.
Синоним гена:E430039K10Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52280-ACGRBS22240
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52280-ACRRBS22240
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52280-ANGRBS22240
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52280-ANRRBS22240
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52280-CFRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52280-CHRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52280-CMRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52280-CYRBS20190
Мышь RBM10 Джин клон кДНК в вектор клонированияMG52280-GRBS5130
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52280-NFRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52280-NHRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52280-NMRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52280-NYRBS20190
Мышь RBM10 Джин ORF экспрессии кДНК клона плазмидыMG52280-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52280-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».