Быстрый заказ

Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RBM10 Информация о продукте «Клон cDNA»
    Размер кДНК:2562bp
    Описание кДНК:Full length Clone DNA of Mus musculus RNA binding motif protein 10 with C terminal His tag.
    Синоним гена:E430039K10Rik
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with RBM10 qPCR primers for gene expression analysis, MP202153 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52280-ACGRBS22240
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52280-ACRRBS22240
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52280-ANGRBS22240
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52280-ANRRBS22240
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52280-CFRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52280-CHRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52280-CMRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52280-CYRBS20190
    Мышь RBM10 Джин клон кДНК в вектор клонированияMG52280-GRBS5130
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52280-NFRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52280-NHRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52280-NMRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52280-NYRBS20190
    Мышь RBM10 Джин ORF экспрессии кДНК клона плазмидыMG52280-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52280-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.