After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь RAN Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RAN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009391.3
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Mus musculus RAN, member RAS oncogene family.
Синоним гена:Ran
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52450-ACGRBS15396
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52450-ACRRBS15396
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52450-ANGRBS15396
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52450-ANRRBS15396
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52450-CFRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52450-CHRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52450-CMRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52450-CYRBS13343
Мышь RAN Джин клон кДНК в вектор клонированияMG52450-GRBS5132
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52450-NFRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52450-NHRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52450-NMRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52450-NYRBS13343
Мышь RAN Джин ORF экспрессии кДНК клона плазмидыMG52450-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52450-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».