Быстрый заказ

Мышь RAN Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RAN Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_009391.3
    Размер кДНК:651bp
    Описание кДНК:Full length Clone DNA of Mus musculus RAN, member RAS oncogene family.
    Синоним гена:Ran
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RAN qPCR primers for gene expression analysis, MP202323 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52450-ACGRBS15400
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52450-ACRRBS15400
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52450-ANGRBS15400
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52450-ANRRBS15400
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52450-CFRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52450-CHRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52450-CMRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52450-CYRBS13340
    Мышь RAN Джин клон кДНК в вектор клонированияMG52450-GRBS5130
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52450-NFRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52450-NHRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52450-NMRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52450-NYRBS13340
    Мышь RAN Джин ORF экспрессии кДНК клона плазмидыMG52450-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52450-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».