RALB cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

RALB cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Mouse v-ral simian leukemia viral oncogene homolog B (ras related) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RALB cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

5730472O18Rik cDNA ORF Clone, Mouse

RALB Background Information

The importance of RALB signaling across the genetically diverse spectrum of AML, the specific mechanism(s) that promotes leukemic cell survival downstream of RALB, and how to pharmacologically target RALB signaling effectively - RALB has emerged as a critical Ras effector and potential therapeutic target for AML. The Ras oncogene-independent activation of RALB signaling is a therapeutically targetable mechanism of escape from NRAS oncogene addiction in AML. Knockdown of RALB led to decreased phosphorylation of TBK1 and reduced BCL2 expression, providing mechanistic insight into RALB survival signaling in AML.
Full Name
v-ral simian leukemia viral oncogene homolog B
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait