Быстрый заказ

Мышь RALA Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь RALA Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_019491.5
    Размер кДНК:621bp
    Описание кДНК:Full length Clone DNA of Mus musculus v-ral simian leukemia viral oncogene homolog A (ras related).
    Синоним гена:Ral, Rasl1, AW322615, 3010001O15Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RALA qPCR primers for gene expression analysis, MP202349 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52476-ACGRBS15400
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52476-ACRRBS15400
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52476-ANGRBS15400
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52476-ANRRBS15400
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52476-CFRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52476-CHRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52476-CMRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52476-CYRBS13340
    Мышь RALA Джин клон кДНК в вектор клонированияMG52476-GRBS5130
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52476-NFRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52476-NHRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52476-NMRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52476-NYRBS13340
    Мышь RALA Джин ORF экспрессии кДНК клона плазмидыMG52476-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52476-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».