Быстрый заказ

Text Size:AAA

Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse RAC2 Информация о продукте «Клон cDNA»
Размер кДНК:579bp
Описание кДНК:Full length Clone DNA of Mus musculus RAS-related C3 botulinum substrate 2 with C terminal Myc tag.
Синоним гена:AI323801, AI452260
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52761-ACGRBS15396
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52761-ACRRBS15396
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52761-ANGRBS15400
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52761-ANRRBS15396
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52761-CFRBS13340
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52761-CHRBS13343
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52761-CMRBS13340
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52761-CYRBS13343
Мышь RAC2 Джин клон кДНК в вектор клонированияMG52761-GRBS5130
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52761-NFRBS13343
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52761-NHRBS13343
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52761-NMRBS13343
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52761-NYRBS13343
Мышь RAC2 Джин ORF экспрессии кДНК клона плазмидыMG52761-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.

  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • Size / Price
    Каталог: MG52761-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.