Быстрый заказ

Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь RAB28 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027295.3
Размер кДНК:666 bp
Описание кДНК:Full length Clone DNA of Mus musculus RAB28, member RAS oncogene family
Синоним гена:2700023P08Rik,AW496496
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB28 qPCR primers for gene expression analysis, MP202163 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52290-ACGRBS15400
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52290-ACRRBS15400
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52290-ANGRBS15400
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52290-ANRRBS15400
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52290-CFRBS13340
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52290-CHRBS13340
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52290-CMRBS13340
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52290-CYRBS13340
Mouse RAB28 Gene cDNA clone plasmidMG52290-GRBS5130
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52290-NFRBS13340
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52290-NHRBS13340
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52290-NMRBS13340
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52290-NYRBS13340
Мышь RAB28 Джин клон кДНК в вектор клонированияMG52290-URBS5130
Мышь RAB28 Джин ORF экспрессии кДНК клона плазмидыMG52290-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52290-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».