After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRSS8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133351.2
Размер кДНК:1020bp
Описание кДНК:Full length Clone DNA of Mus musculus protease, serine, 8 (prostasin) with N terminal His tag.
Синоним гена:CAP1, mCAP1, C79772, AI313909, 2410039E18Rik
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50120-ACGRBS15400
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50120-ACRRBS15400
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50120-CFRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50120-CHRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50120-CMRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50120-CYRBS13340
Мышь Prostasin/PRSS8 Джин клон кДНК в вектор клонированияMG50120-MRBS5130
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50120-NFRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50120-NHRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50120-NMRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50120-NYRBS13340
Мышь Prostasin/PRSS8 Джин ORF экспрессии кДНК клона плазмидыMG50120-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Prostasin (Prss8), also known as channel activating protease 1 (CAP1), is a trypsinlike serine peptidase, and plays important roles in epithelial physiology. It is originally purified as an active, soluble enzyme from human seminal fluid and is highly expressed in prostate, lung, kidney, salivary gland and pancreas. Prostasin is expressed as a glycosyl-phosphatidylinositol (GPI)-anchored membrane protein in prostate epithelial cells, and also exists as a secreted proteolytic enzyme possibly via tryptic cleavage of its COOH-terminal hydrophobic domain. Prostasin is found to activate the epithelial sodium channel (ENaC) which is tightly regulated and is critical for maintaining salt and fluid balance in the lung and kidney in both normal and pathological conditions. Accordingly, prostasin has been proposed as a target for therapeutic inhibition in cystic fibrosis. In addition, prostasin inhibits prostate and breast cancer cell invasion in vitro, suggesting a functional role as a suppressor of tumor invasion, as well as a regulator of gene expression during inflammation.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».