Быстрый заказ

Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PGLYRP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009402.2
Размер кДНК:549bp
Описание кДНК:Full length Clone DNA of Mus musculus peptidoglycan recognition protein 1 with N terminal His tag.
Синоним гена:PGRP, Tag7, Tasg7, PGRP-S, Pglyrp, Tnfsf3l
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50115-ACGRBS15400
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50115-ACRRBS15400
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50115-CFRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50115-CHRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50115-CMRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50115-CYRBS13340
Мышь PGLYRP1/PGRP-S Джин клон кДНК в вектор клонированияMG50115-MRBS5130
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50115-NFRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50115-NHRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50115-NMRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50115-NYRBS13340
Мышь PGLYRP1/PGRP-S Джин ORF экспрессии кДНК клона плазмидыMG50115-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse Peptidoglycan recognition protein 1, also known as Peptidoglycan recognition protein short, PGRP-S, PGLYRP1, PGLYRP, PGRP and TNFSF3L, is a secreted protein which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. PGLYRP1 / PGLYRP is highly expressed in bone marrow. It is weakly expressed in kidney, liver, small intestine, spleen, thymus, peripheral leukocyte, lung, fetal spleen and neutrophils. PGLYRP1 / PGLYRP is a pattern receptor that binds to murein peptidoglycans (PGN) of Gram-positive bacteria. It has bactericidal activity towards Gram-positive bacteria. PGLYRP1 / PGLYRP may kill Gram-positive bacteria by interfering with peptidoglycan biosynthesis. It binds also to Gram-negative bacteria, and has bacteriostatic activity towards Gram-negative bacteria.

Peptidoglycan recognition proteins ( PGRPs or PGLYRPs ) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs: PGLYRP1, PGLYRP2, PGLYRP3, and PGLYRP4. They are secreted proteins expressed in polymorphonuclear leukocytes ( PGLYRP1 ), liver ( PGLYRP2 ), or on body surfaces, mucous membranes, and in secretions (saliva, sweat) (PGLYRP3 and PGLYRP4). All PGRPs recognize bacterial peptidoglycan. The PGRPs likely play a role both in antibacterial defenses and several inflammatory diseases. They modulate local inflammatory responses in tissues (such as arthritic joints) and there is evidence for association of PGRPs with inflammatory diseases, such as psoriasis.

Size / Price
Каталог: MG50115-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».