After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PYGB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_153781.1
Размер кДНК:2532bp
Описание кДНК:Full length Clone DNA of Mus musculus brain glycogen phosphorylase.
Синоним гена:RP23-241M12.1, Pygb
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51358-ACGRBS22240
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51358-ACRRBS22240
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51358-ANGRBS22240
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51358-ANRRBS22240
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51358-CFRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51358-CHRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51358-CMRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51358-CYRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51358-NFRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51358-NHRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51358-NMRBS20190
Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51358-NYRBS20190
Мышь PYGB Джин клон кДНК в вектор клонированияMG51358-URBS5130
Мышь PYGB Джин ORF экспрессии кДНК клона плазмидыMG51358-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51358-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».