Быстрый заказ

Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PYGB Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_153781.1
    Размер кДНК:2532bp
    Описание кДНК:Full length Clone DNA of Mus musculus brain glycogen phosphorylase.
    Синоним гена:RP23-241M12.1, Pygb
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PYGB qPCR primers for gene expression analysis, MP201235 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51358-ACGRBS22240
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51358-ACRRBS22240
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51358-ANGRBS22240
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51358-ANRRBS22240
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51358-CFRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51358-CHRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51358-CMRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51358-CYRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51358-NFRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51358-NHRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51358-NMRBS20190
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51358-NYRBS20190
    Мышь PYGB Джин клон кДНК в вектор клонированияMG51358-URBS5130
    Мышь PYGB Джин ORF экспрессии кДНК клона плазмидыMG51358-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51358-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».