After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PTPN11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001109992.1
Размер кДНК:1782bp
Описание кДНК:Full length Clone DNA of Mus musculus protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 with N terminal Flag tag.
Синоним гена:Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
Виды:Mouse
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50462-ACGRBS16760
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50462-ACRRBS16760
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50462-ANGRBS16760
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50462-ANRRBS16760
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50462-CFRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50462-CHRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50462-CMRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50462-CYRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин клон кДНК в вектор клонированияMG50462-MRBS5130
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50462-NFRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50462-NHRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50462-NMRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50462-NYRBS14710
Мышь SHP2 / PTPN11 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыMG50462-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

Ссылки
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    Каталог: MG50462-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».