After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PTMA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008972.2
Размер кДНК:336bp
Описание кДНК:Full length Clone DNA of Mus musculus prothymosin alpha.
Синоним гена:Thym, MGC102090, MGC103390, Ptma
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50272-ACGRBS15400
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50272-ACRRBS15400
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50272-ANGRBS15400
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50272-ANRRBS15400
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50272-CFRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50272-CHRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50272-CMRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50272-CYRBS13340
Мышь PTMA Джин клон кДНК в вектор клонированияMG50272-MRBS5130
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50272-NFRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50272-NHRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50272-NMRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50272-NYRBS13340
Мышь PTMA Джин ORF экспрессии кДНК клона плазмидыMG50272-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

Ссылки
  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    Каталог: MG50272-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».