After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PTK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007982.2
Размер кДНК:3159bp
Описание кДНК:Full length Clone DNA of Mus musculus PTK2 protein tyrosine kinase 2 with C terminal His tag.
Синоним гена:FAK, FRNK, Fadk, KIAA4203, mKIAA4203, Ptk2
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50470-ACGRBS22240
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50470-ACRRBS22240
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50470-CFRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50470-CHRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50470-CMRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50470-CYRBS20190
Мышь PTK2/FAK1 Джин клон кДНК в вектор клонированияMG50470-MRBS5130
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50470-NFRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50470-NHRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50470-NMRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50470-NYRBS20190
Мышь PTK2/FAK1 Джин ORF экспрессии кДНК клона плазмидыMG50470-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50470-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».