Быстрый заказ

Text Size:AAA

Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PSPH Информация о продукте «Клон cDNA»
Размер кДНК:678bp
Описание кДНК:Full length Clone DNA of Mus musculus phosphoserine phosphatase with N terminal Flag tag.
Синоним гена:PSP; PSPase; AI480570
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51854-ACGRBS15400
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51854-ACRRBS15400
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51854-ANGRBS15400
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51854-ANRRBS15400
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51854-CFRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51854-CHRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51854-CMRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51854-CYRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51854-NFRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51854-NHRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51854-NMRBS13340
Мышь PSPH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51854-NYRBS13340
Мышь PSPH Джин клон кДНК в вектор клонированияMG51854-URBS5130
Мышь PSPH Джин ORF экспрессии кДНК клона плазмидыMG51854-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Phosphoserine phosphatase (PSPH) belongs to a subfamily of the phosphotransferases. PSPH is the rate-limiting enzyme in l-serine biosynthesis. It has previously been found that Phosphoserine phosphatase (PSPH) plays a role in epidermal homeostasis. Phosphoserine phosphatase (PSP) catalyzes the hydrolysis of phosphoserine to serine. Phosphoserine phosphatase (PSPH) expression has been examined in human-mouse somatic cell hybrids retaining different combination of human chromosomes. Phosphoserine phosphatase (PSPH) is expressed throughout the proliferative layer of the epidermis and hair follicles in rodent and human skin and is highly induced in SCC. In keratinocytes, Phosphoserine phosphatase (PSPH) is a cytoplasmic protein that primarily localizes to endosomes and is present primarily as a homodimer. Knock down of Phosphoserine phosphatase (PSPH) dramatically diminished SCC cell proliferation and cyclin D1 levels in the presence of exogenous of l-serine production suggesting a non-canonical role for Phosphoserine phosphatase (PSPH) in epithelial carcinogenesis. Phosphoserine phosphatase (PSPH) is highly induced in proliferative normal keratinocytes and in skin tumors. Phosphoserine phosphatase (PSPH) appears to be critical for the proliferation of SCC cells; however, this phenomenon may not involve the phosphoserine metabolic pathway.

  • Bachelor MA, et al. (2011) L-3-Phosphoserine phosphatase (PSPH) regulates cutaneous squamous cell carcinoma proliferation independent of L-serine biosynthesis. J Dermatol Sci. 63(3): 164-72.
  • Koch GA, et al. (1983) Assignment of the human phosphoserine phosphatase gene (PSP) to the pter leads to q22 region of chromosome 7. Cytogenet Cell Genet. 35(1): 67-9.
  • Jaeken J, et al. (1997) Phosphoserine phosphatase deficiency in a patient with Williams syndrome. J Med Genet. 34(7): 594-6.
  • Size / Price
    Каталог: MG51854-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.